Review



gst hp1a plasmid  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Addgene inc gst hp1a plasmid
    Gst Hp1a Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gst+hp1a+plasmid/heterochromatin+protein+hp1a/pm37870432__ja3c06481_si_001-14-12-20
    Average 90 stars, based on 1 article reviews
    gst hp1a plasmid - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Phosphorylated HP1α-Nucleosome Interactions in Phase Separated Environments.
    Article Snippet: .. TCTCCAGGCACGTGTCAGATATATACATCCTGTGCATGTAAGATCCAGT The HP1a chromodomain and chromoshadow domain genes were excised from a GST HP1a plasmid provided by Naoko Tanese (2) (Addgene plasmid #24074; http://n2t.net/addgene:24074; RRID:Addgene_24074), and cloned into a pET vector backbone of a 2BT MacroLab plasmid (generously provided by Dr. Kevin Corbett) using NEBuilder HiFi DNA Assembly Master Mix. ..

    Clone Assay:

    Article Title: Phosphorylated HP1α-Nucleosome Interactions in Phase Separated Environments.
    Article Snippet: .. TCTCCAGGCACGTGTCAGATATATACATCCTGTGCATGTAAGATCCAGT The HP1a chromodomain and chromoshadow domain genes were excised from a GST HP1a plasmid provided by Naoko Tanese (2) (Addgene plasmid #24074; http://n2t.net/addgene:24074; RRID:Addgene_24074), and cloned into a pET vector backbone of a 2BT MacroLab plasmid (generously provided by Dr. Kevin Corbett) using NEBuilder HiFi DNA Assembly Master Mix. ..



    Similar Products

    gst hp1a plasmid  (Addgene inc)
    90
    Addgene inc gst hp1a plasmid
    Gst Hp1a Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gst+hp1a+plasmid/heterochromatin+protein+hp1a/pm37870432__ja3c06481_si_001-14-12-20
    Average 90 stars, based on 1 article reviews
    gst hp1a plasmid - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results